| PCR: | C9orf |
| Name of Positive CTRL: | C9orf |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 40.0 |
Extension Time: | 60 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 1076 | 775 | 100 µM | 20.0 µl for 1ml | GCTGTTTTGCCTTTCTTTGC |
| 1077 | 776 | 100 µM | 20.0 µl for 1ml | GTGGGTTAGAGGGTGCTGAA |
| B-globin-3 | 774 | 100 µM | 10.0 µl for 1ml | CCTTGAGGCTGTCCAAGTGATTCAGGCCATCG |
| B-globin-5 | 773 | 100 µM | 10.0 µl for 1ml | CCAATCTGCTCACACAGGATAGAGAGGGCAGG |
|
| Expected Bands: | Band Size: 300.0 | Description: 300 C9orf | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 bglobi | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |