| PCR: | FSM |
| Name of Positive CTRL: | FSN |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 40.0 |
Extension Time: | 30 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| P1-TTC7 FW | 771 | 100 µM | 10.0 µl for 1ml | CAAGATGCTTGCTTCTGG |
| P2-ETn RV | 772 | 100 µM | 17.5 µl for 1ml | CCGATACGAAGATCCTTTCC |
| wt_TTC7 RV | 770 | 100 µM | 5.0 µl for 1ml | GAAGAGCAGCGCTAGCAAGT |
|
| Expected Bands: | Band Size: 191.0 | Description: 191 wt | (text displayed in the image) |
| Band Size: 450.0 | Description: 450 mutant | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |