| PCR: | IRES-DTR |
| Name of Positive CTRL: | IRES-DTR |
Annealing Temperature: | 62.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 10 s | | Hot Start: | HS 62 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 5248 | 769 | 100 µM | 10.0 µl for 1ml | GGAAAATGCATGGTCTATCCTAGC |
| 5424 | 768 | 100 µM | 20.0 µl for 1ml | GGGAGAGGGGCATAACTTCGTATAGC |
| 5454 | 767 | 100 µM | 30.0 µl for 1ml | GACTCAGTGGCTATTCCGTCTACTTG |
|
| Expected Bands: | Band Size: 452.0 | Description: 452 tg | (text displayed in the image) |
| Band Size: 562.0 | Description: 562 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |