PCR:	Teto-dnSNARE
Name of Positive CTRL:	Teto-dnSNARE
Annealing Temperature:	61.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	5.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	5.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	Teto-dnSNARE F	763	100 µM	20.0 µl for 1ml	TGGATAAAGAAGCTCATTAATTGTCA
	Teto-dnSNARE R	764	100 µM	20.0 µl for 1ml	GCG GAT CCA GAC ATG ATA AGA
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 1400.0	Description: 1400	(text displayed in the image)
More Information in PDF:		view PDF