PCR: | XPR1 |
Name of Positive CTRL: | XPR1 |
Annealing Temperature: | 65.0 °C | Number of cycles: | 35.0 |
Extension Time: | 60 s | Hot Start: | HS 65 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| CSD-loxF | 760 | 100 µM | 10.0 µl for 1ml | GAGATGGCGCAACGCAATTAATG |
| CSD-Xpr1-F | 758 | 100 µM | 20.0 µl for 1ml | ACAGCTTGTGGAGTTGGTTCTCTCC |
| CSD-Xpr1-R | 759 | 100 µM | 10.0 µl for 1ml | GACTGGCTAGCTCTGTTGTTTCTGG |
| CSD-Xpr1-ttR | 757 | 100 µM | 20.0 µl for 1ml | TATTCTCTGAGCTCCACATGCCTGC |
|
Expected Bands: | Band Size: 350.0 | Description: 350 flox | (text displayed in the image) |
| Band Size: 529.0 | Description: 529 wt | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|