| PCR: | Vglut2-ires-cre |
| Name of Positive CTRL: | Vglut2-ires-cre |
Annealing Temperature: | 65.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 11642 | 742 | 100 µM | 10.0 µl for 1ml | ATCGACCGGTAATGCAGGCAA |
| 13126 | 743 | 100 µM | 20.0 µl for 1ml | CGGTACCACCAAATCTTACGG |
| 13127 | 744 | 100 µM | 10.0 µl for 1ml | CATGGTCTGTTTTGAATTCAG |
|
| Expected Bands: | Band Size: 299.0 | Description: 299 wt | (text displayed in the image) |
| Band Size: 850.0 | Description: 850 mut | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |