| PCR: | SERT-Cre |
| Name of Positive CTRL: | SERT-Cre |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 27665 | 745 | 100 µM | 20.0 µl for 1ml | GAGCTCTCAGTCTTGTCTCCA |
| 27666 | 746 | 100 µM | 10.0 µl for 1ml | GAGTGTGGCGCTTCATCC |
| oIMR9074 | 747 | 100 µM | 10.0 µl for 1ml | AGGCAAATTTTGGTGTACGG |
|
| Expected Bands: | Band Size: 195.0 | Description: 192 mut | (text displayed in the image) |
| Band Size: 295.0 | Description: 295 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |