PCR:	DBH-Cre
Name of Positive CTRL:	DBH-Cre
Annealing Temperature:	60.0 °C
Number of cycles:	30.0
Extension Time:	120 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Cre	748	100 µM	10.0 µl for 1ml	CTAATCGCCATCTTCCAGCAGG
	hDBH	749	100 µM	10.0 µl for 1ml	GAAGGGACAGCATCCGCCTGTC
	mLC3ex3GT	750	100 µM	10.0 µl for 1ml	TGAGCGAGCTCATCAAGATAATCAGGT
	mLC3ex4AG	751	100 µM	10.0 µl for 1ml	GTTAGCATTGAGCTGCAAGCGCCGTCT
Expected Bands:	Band Size: 550.0	Description: 550 IC Lc3	(text displayed in the image)
	Band Size: 1800.0	Description: 1800 tg	(text displayed in the image)
More Information in PDF:		view PDF