PCR:	ROSA26-GNZ-KI
Name of Positive CTRL:	ROSA26-GNZ-KI
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	oIMR8038	752	100 µM	20.0 µl for 1ml	TAAGCCTGCCCAGAAGACTC
	oIMR8545	585	100 µM	10.0 µl for 1ml	AAA GTC GCT CTG AGT TGT TAT
	oIMR9539	753	100 µM	10.0 µl for 1ml	TCCAGTTCAACATCAGCCGCTACA
Expected Bands:	Band Size: 235.0	Description: 235 wt	(text displayed in the image)
	Band Size: 575.0	Description: 575 mut	(text displayed in the image)
More Information in PDF:		view PDF