PCR:	Flop-iDTR
Name of Positive CTRL:	Flop-iDTR
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	EYFP-wt	442	100 µM	10.0 µl for 1ml	GGA GCG GGA GAA ATG GAT ATG
	oIMR8128	738	100 µM	10.0 µl for 1ml	CATCAAGGAAACCCTGGACTACTG
	oIMR8545	585	100 µM	20.0 µl for 1ml	AAA GTC GCT CTG AGT TGT TAT
Expected Bands:	Band Size: 242.0	Description: 242 ko	(text displayed in the image)
	Band Size: 603.0	Description: 603 wt	(text displayed in the image)
More Information in PDF:		view PDF