PCR:	GCaMP6f
Name of Positive CTRL:	GCaMP6f
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	GCaMP6f-Fw	734	100 µM	20.0 µl for 1ml	CATCAGTGCAGCAGAGCTTC
	GCaMP6f-Rev	735	100 µM	20.0 µl for 1ml	CAGCGTATCCACATAGCGTA
Expected Bands:	Band Size: 285.0	Description: 285GCamP6f	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF