PCR:	Sall1 flox
Name of Positive CTRL:	Sall1 flox
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Sall1 flox2	731	100 µM	10.0 µl for 1ml	CCTCTGCCCGAGAGATCG
	Sall1 flox3	732	100 µM	10.0 µl for 1ml	GGCGCGTCTGATTTTATTTC
	Sall1 flox5	733	100 µM	10.0 µl for 1ml	AGGAACACTCACGAAATGGG
Expected Bands:	Band Size: 220.0	Description: 220 wt	(text displayed in the image)
	Band Size: 280.0	Description: 280 mut	(text displayed in the image)
	Band Size: 350.0	Description: 350 delta	(text displayed in the image)
More Information in PDF:		view PDF