PCR: Rxratm1Krc
Name of Positive CTRL:Rxratm1Krc
Annealing Temperature:60.0 °C
Number of cycles:35.0
Extension Time:60 s
Hot Start:HS 60
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
14341729100 µM20.0 µl for 1mlCCATCCCTCAGGAAATATGG
14342730100 µM20.0 µl for 1mlAGAGGATGGGTGAACTTAATGACA
Expected Bands:Band Size: 613.0Description: 613 wt(text displayed in the image)
Band Size: 700.0Description: 700 mut(text displayed in the image)
 
More Information in PDF: view PDF