PCR: | Rxratm1Krc | ||||
Name of Positive CTRL: | Rxratm1Krc | Annealing Temperature: | 60.0 °C | ||
Number of cycles: | 35.0 | Extension Time: | 60 s | ||
Hot Start: | HS 60 | ||||
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
14341 | 729 | 100 µM | 20.0 µl for 1ml | CCATCCCTCAGGAAATATGG | |
14342 | 730 | 100 µM | 20.0 µl for 1ml | AGAGGATGGGTGAACTTAATGACA | |
Expected Bands: | Band Size: 613.0 | Description: 613 wt | (text displayed in the image) | ||
Band Size: 700.0 | Description: 700 mut | (text displayed in the image) | |||
More Information in PDF: | view PDF | ||||