PCR:	D6Slab17
Name of Positive CTRL:	D6Slab17
Annealing Temperature:	52.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 53
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	D6Slab17pA	725	100 µM	10.0 µl for 1ml	TTGATAGTTCCACTGTTCTGGC
	D6Slab17pB	726	100 µM	10.0 µl for 1ml	GTAACAATACAGCAAGAGATAC
	Snca Ex 6 Fwd	727	100 µM	10.0 µl for 1ml	AAGACTATGAGCCTGAAGCCTAAG
	Snca Ex 6 Rev	728	100 µM	10.0 µl for 1ml	AGTGTGAAGCCACAACAATATCC
Expected Bands:	Band Size: 179.0	Description: 179D6Slab1	(text displayed in the image)
	Band Size: 266.0	Description: 266 Snca	(text displayed in the image)
More Information in PDF:		view PDF