PCR:	Nnt7
Name of Positive CTRL:	Nnt7
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Nnt Ex 7 Fwd	720	100 µM	10.0 µl for 1ml	ATTTAGCTGCTGAGGCTGGA
	Nnt Ex 7 Rev	721	100 µM	10.0 µl for 1ml	GACAAAGACCCGAGAAGCAC
Expected Bands:	Band Size: 229.0	Description: 229 Nnt7	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF