| PCR: | Gkn2wt |
| Name of Positive CTRL: | Gkn2wt |
Annealing Temperature: | 55.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Actin fwd | 114 | 100 µM | 10.0 µl for 1ml | TGT TAC CAA CTG GGA CGA CA |
| Actin rev | 115 | 100 µM | 10.0 µl for 1ml | GAC ATG CAA GGA GTG CAA GA |
| Reg-Gkn2-wtF | 713 | 100 µM | 20.0 µl for 1ml | TCCAAAGATATCGCTCCAGCTCTCC |
| Reg-Gkn2-wtR | 712 | 100 µM | 20.0 µl for 1ml | CTGGAAGCCCATATGAAGCTCATGC |
|
| Expected Bands: | Band Size: 116.0 | Description: 116 wt | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 Actin | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |