| PCR: | Gkn2 PreCre |
| Name of Positive CTRL: | Gkn2 PreCre |
Annealing Temperature: | 55.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| mTUBB5-247 F | 277 | 100 µM | 10.0 µl for 1ml | CGG CCA CCA TGA GCG GCG TC |
| mTUBB5-247 R | 392 | 100 µM | 10.0 µl for 1ml | GTG AGG TAC CGG CCG TGG CG |
| Reg-Gkn2-R | 711 | 100 µM | 20.0 µl for 1ml | AATATACCAAGCCCCACCCTCTTCC |
| Reg-NeoF | 707 | 100 µM | 20.0 µl for 1ml | GCAGCCTCTGTTCCACATACACTTCA |
|
| Expected Bands: | Band Size: 247.0 | Description: mTUBB-247 | (text displayed in the image) |
| Band Size: 624.0 | Description: 624 PreCre | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |