PCR:	Gkn1wt
Name of Positive CTRL:	Gkn1wt
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Reg-Gkn1-wtF	710	100 µM	20.0 µl for 1ml	GTCTAGAGGAGTGATTCTCGACCTTCC
	Reg-Gkn1-wtR	709	100 µM	20.0 µl for 1ml	GCATGATGTTATCTCCTGTAAATGAGG
Expected Bands:	Band Size: 284.0	Description: 284 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF