PCR:	GrnKO
Name of Positive CTRL:	GrnKO
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	49109_F	704	100 µM	30.0 µl for 1ml	CGGAACACAGTGTCCAGATG
	49296_R	705	100 µM	10.0 µl for 1ml	ATCAACCAAAGGGTCTGTGC
	50086_R	706	100 µM	20.0 µl for 1ml	GTGGCAGAGTCAGGACATTCAAACT
Expected Bands:	Band Size: 188.0	Description: 188 wt	(text displayed in the image)
	Band Size: 589.0	Description: 589 ko	(text displayed in the image)
	Band Size: 978.0	Description: 978wtnav	(text displayed in the image)
More Information in PDF:		view PDF