PCR:	FUS-KI
Name of Positive CTRL:	FUS-KI
Annealing Temperature:	62.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	LF-6046	702	100 µM	10.0 µl for 1ml	GATTTGAAGTGGGTAGATAGTGCAGG
	LR-6047	703	100 µM	10.0 µl for 1ml	CCTTTCCACACTTTAGGTTAGTCACAG
Expected Bands:	Band Size: 160.0	Description: 160 wt	(text displayed in the image)
	Band Size: 240.0	Description: 240 KI	(text displayed in the image)
More Information in PDF:		view PDF