PCR:	Hprt
Name of Positive CTRL:	Hprt
Annealing Temperature:	54.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	8.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	8.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	oIMR0801	700	100 µM	20.0 µl for 1ml	GGCAAAGGATGTGATACGTGGAAG
	oIMR0802	701	100 µM	20.0 µl for 1ml	CCAGTTTCACTAATGACACAAACATG
Expected Bands:	Band Size: 247.0	Description: mTUBB-247	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
	Band Size: 850.0	Description: 850 mut	(text displayed in the image)
More Information in PDF:		view PDF