PCR: | Hprt |
Name of Positive CTRL: | Hprt |
Annealing Temperature: | 54.0 °C | Number of cycles: | 35.0 |
Extension Time: | 60 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| mTUBB5-247 F | 277 | 100 µM | 8.0 µl for 1ml | CGG CCA CCA TGA GCG GCG TC |
| mTUBB5-247 R | 392 | 100 µM | 8.0 µl for 1ml | GTG AGG TAC CGG CCG TGG CG |
| oIMR0801 | 700 | 100 µM | 20.0 µl for 1ml | GGCAAAGGATGTGATACGTGGAAG |
| oIMR0802 | 701 | 100 µM | 20.0 µl for 1ml | CCAGTTTCACTAATGACACAAACATG |
|
Expected Bands: | Band Size: 247.0 | Description: mTUBB-247 | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 Actin | (text displayed in the image) |
| Band Size: 850.0 | Description: 850 mut | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|