PCR:	Rosa-Cas9 wt
Name of Positive CTRL:	Rosa-Cas9 wt
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Rosa-Cas9 F	343	100 µM	20.0 µl for 1ml	aag gga gct gca gtg gag ta
	Rosa-Cas9 wt	699	100 µM	20.0 µl for 1ml	CCGAAAATCTGTGGGAAGTC
Expected Bands:	Band Size: 297.0	Description: 297 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF