| PCR: | Dio3 |
| Name of Positive CTRL: | Dio3 |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 45 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Cmdio3U | 693 | 100 µM | 20.0 µl for 1ml | CCTCTACGTCATCCAGAGTGGCA |
| mdio3real1L | 694 | 100 µM | 20.0 µl for 1ml | TGGCCAACAAGTCCGAGCTGTGAA |
|
| Expected Bands: | Band Size: 505.0 | Description: 505 wt | (text displayed in the image) |
| Band Size: 574.0 | Description: 574 loxed | (text displayed in the image) |
| Band Size: 1250.0 | Description: 1250 unsp | (text displayed in the image) |
| Band Size: 1600.0 | Description: 1600 unsp | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |