| PCR: | Kras wt/mut |
| Name of Positive CTRL: | Kras mut/wt |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 22907 Kras wt F | 695 | 100 µM | 10.0 µl for 1ml | TGTCTTTCCCCAGCACAGT |
| 22908 Kras R | 696 | 100 µM | 20.0 µl for 1ml | CTGCATAGTACGCTATACCCTGT |
| oIMR9592 Kras mut F | 697 | 100 µM | 10.0 µl for 1ml | GCAGGTCGAGGGACCTAATA |
|
| Expected Bands: | Band Size: 100.0 | Description: 100 mut | (text displayed in the image) |
| Band Size: 250.0 | Description: 250 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |