PCR:	ASC
Name of Positive CTRL:	ASC
Annealing Temperature:	57.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	SM105_CASC	686	100 µM	20.0 µl for 1ml	CTAAGCACAGTCATTGTGAGCTCC
	SM141_NeoSeg6	687	100 µM	10.0 µl for 1ml	AAGACAATAGCAGGCATGCTGG
	SM99_gASC	685	100 µM	10.0 µl for 1ml	CTAGTTTGCTGGGGAAAGAAC
Expected Bands:	Band Size: 260.0	Description: 260 mut	(text displayed in the image)
	Band Size: 450.0	Description: 450 wt	(text displayed in the image)
More Information in PDF:		view PDF