PCR:	Cacna2d1 ko
Name of Positive CTRL:	Cacna2d1 ko
Annealing Temperature:	52.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Primer B - α2δ-1	681	100 µM	20.0 µl for 1ml	CTGCACGAGACTAGTGAGACG
	Primer C - α2δ-1	682	100 µM	20.0 µl for 1ml	ACATTCTCAAGACTGTAGGCAGAG
Expected Bands:	Band Size: 635.0	Description: 635 ko	(text displayed in the image)
More Information in PDF:		view PDF