PCR:	Cacna2d1 wt
Name of Positive CTRL:	Cacna2d1 wt
Annealing Temperature:	52.0 °C
Number of cycles:	25.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Primer A - α2δ-1	680	100 µM	20.0 µl for 1ml	GAGCTTTCTTTCTTCTGATTCCAC
	Primer C - α2δ-1	682	100 µM	20.0 µl for 1ml	ACATTCTCAAGACTGTAGGCAGAG
Expected Bands:	Band Size: 346.0	Description: 346 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF