PCR: TDP-M337V
Name of Positive CTRL:TDP-M337V
Annealing Temperature:65.0 °C
Number of cycles:35.0
Extension Time:60 s
Hot Start:HS 57
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
13913683100 µM20.0 µl for 1mlCTTTGGTGCGTTCAGCATTA
13914684100 µM20.0 µl for 1mlCCTATGGGGGACACAGAGAA
oIMR7338487100 µM2.5 µl for 1mlCTA GGC CAC AGA ATT GAA AGA TCT
oIMR7339488100 µM2.5 µl for 1mlGTA GGT GGA AAT TCT AGC ATC ATC C
Expected Bands:Band Size: 324.0Description: 324control(text displayed in the image)
Band Size: 454.0Description: 454 tg(text displayed in the image)
 
More Information in PDF: view PDF