PCR: | TDP-M337V |
Name of Positive CTRL: | TDP-M337V |
Annealing Temperature: | 65.0 °C | Number of cycles: | 35.0 |
Extension Time: | 60 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 13913 | 683 | 100 µM | 20.0 µl for 1ml | CTTTGGTGCGTTCAGCATTA |
| 13914 | 684 | 100 µM | 20.0 µl for 1ml | CCTATGGGGGACACAGAGAA |
| oIMR7338 | 487 | 100 µM | 5.0 µl for 1ml | CTA GGC CAC AGA ATT GAA AGA TCT |
| oIMR7339 | 488 | 100 µM | 5.0 µl for 1ml | GTA GGT GGA AAT TCT AGC ATC ATC C |
|
Expected Bands: | Band Size: 324.0 | Description: 324control | (text displayed in the image) |
| Band Size: 454.0 | Description: 454 tg | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|