PCR: | Thy1-TDP |
Name of Positive CTRL: | Thy1-TDP |
Annealing Temperature: | 65.0 °C | Number of cycles: | 35.0 |
Extension Time: | 60 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 13790 | 675 | 100 µM | 20.0 µl for 1ml | TGAAATCCGGGTGGTATTGG |
| 13791 | 676 | 100 µM | 5.0 µl for 1ml | GGTGAGTTTAACCTTCAAGGGCT |
| 13792 | 677 | 100 µM | 10.0 µl for 1ml | AGCTTGCTAGCGGATCCAGAC |
|
Expected Bands: | Band Size: 303.0 | Description: 303 wt | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 mut | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|