PCR: Thy1-TDP
Name of Positive CTRL:Thy1-TDP
Annealing Temperature:65.0 °C
Number of cycles:35.0
Extension Time:60 s
Hot Start:HS 62
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
13790675100 µM20.0 µl for 1mlTGAAATCCGGGTGGTATTGG
13791676100 µM10.0 µl for 1mlGGTGAGTTTAACCTTCAAGGGCT
13792677100 µM10.0 µl for 1mlAGCTTGCTAGCGGATCCAGAC
Expected Bands:Band Size: 303.0Description: 303 wt(text displayed in the image)
Band Size: 500.0Description: 500 mut(text displayed in the image)
 
More Information in PDF: view PDF