PCR:	p53
Name of Positive CTRL:	p53
Annealing Temperature:	56.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	oIMR8543	673	100 µM	10.0 µl for 1ml	GGTTAAACCCAGCTTGACCA
	oIMR8544	674	100 µM	10.0 µl for 1ml	GGAGGCAGAGACAGTTGGAG
Expected Bands:	Band Size: 270.0	Description: 270 wt	(text displayed in the image)
	Band Size: 390.0	Description: 390 mut	(text displayed in the image)
More Information in PDF:		view PDF