PCR:	ROSA26-mT/mG
Name of Positive CTRL:	ROSA26-mT/mG
Annealing Temperature:	61.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	IMR7318	667	100 µM	20.0 µl for 1ml	CTCTGCTGCCTCCTGGCTTCT
	IMR7319	668	100 µM	10.0 µl for 1ml	CGAGGCGGATCACAAGCAATA
	IMR7320	669	100 µM	10.0 µl for 1ml	TCAATGGGCGGGGGTCGTT
Expected Bands:	Band Size: 250.0	Description: 250 mut	(text displayed in the image)
	Band Size: 330.0	Description: 330 wt	(text displayed in the image)
More Information in PDF:		view PDF