| PCR: | C1qA |
| Name of Positive CTRL: | C1qA |
Annealing Temperature: | 64.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Mc1Qa/5\'+ | 664 | 100 µM | 10.0 µl for 1ml | GGGGCCTGTGATCCAGACAG |
| Mc1QIN/2- | 665 | 100 µM | 10.0 µl for 1ml | TAACCATTGCCTCCAGGATGG |
| Neo 3\' | 666 | 100 µM | 20.0 µl for 1ml | GGGGATCGGCAATAAAAAGAC |
|
| Expected Bands: | Band Size: 160.0 | Description: 160 rec. | (text displayed in the image) |
| Band Size: 360.0 | Description: 360 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |