PCR:	Thy1-a2d1
Name of Positive CTRL:	Thy1-a2d1
Annealing Temperature:	62.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	a2d1R4	663	100 µM	20.0 µl for 1ml	TTTCTCTGCTTCCATAGCCAGG
	mTUBB5-247 F	277	100 µM	15.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	15.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	YFP primer 1	553	100 µM	20.0 µl for 1ml	TCT GAG TGG CAA AGG ACC TTA GG
Expected Bands:	Band Size: 247.0	Description: mTUBB-247	(text displayed in the image)
	Band Size: 500.0	Description: 500 tg	(text displayed in the image)
More Information in PDF:		view PDF