PCR:	SOD1
Name of Positive CTRL:	SOD1
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	oIMR0113	661	100 µM	20.0 µl for 1ml	CATCAGCCCTAATCCATCTGA
	oIMR0114	662	100 µM	20.0 µl for 1ml	CGCGACTAACAATCAAAGTGA
	oIMR7338	487	100 µM	10.0 µl for 1ml	CTA GGC CAC AGA ATT GAA AGA TCT
	oIMR7339	488	100 µM	10.0 µl for 1ml	GTA GGT GGA AAT TCT AGC ATC ATC C
Expected Bands:	Band Size: 236.0	Description: 236 tg	(text displayed in the image)
	Band Size: 324.0	Description: 324control	(text displayed in the image)
More Information in PDF:		view PDF