PCR:	RANKflox
Name of Positive CTRL:	RANKflox
Annealing Temperature:	64.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 65
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	P105	659	100 µM	10.0 µl for 1ml	CTGGTGGTTGTTCTCCTGGTGTCAT
	P87	657	100 µM	20.0 µl for 1ml	GGCAGAACTCGGATGCACAGATTGG
	P88	658	100 µM	30.0 µl for 1ml	AGTGTGCCTGGCATGTGCAGACCTT
Expected Bands:	Band Size: 256.0	Description: 256 wt	(text displayed in the image)
	Band Size: 390.0	Description: 390 floxed	(text displayed in the image)
	Band Size: 566.0	Description: 566 delta	(text displayed in the image)
More Information in PDF:		view PDF