PCR:	ZH3 RFLP
Name of Positive CTRL:	ZH3 RFLP +/-
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57 + Dig
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	AL95	655	100 µM	10.0 µl for 1ml	AGGGTTGACGCCATGACTTT
	AL96	656	100 µM	10.0 µl for 1ml	TATGGGTACCCCCTCCTTGG
Expected Bands:	Band Size: 146.0	Description: 146 wt	(text displayed in the image)
	Band Size: 250.0	Description: 250 wt	(text displayed in the image)
	Band Size: 388.0	Description: 388 ZH3	(text displayed in the image)
	Band Size: 460.0	Description: het unsp	(text displayed in the image)
More Information in PDF:		view PDF