| PCR: | 129mmHuTg |
| Name of Positive CTRL: | 129mmHuTg |
Annealing Temperature: | 53.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 129m hutg-fwd | 653 | 100 µM | 20.0 µl for 1ml | CAGTCATTATGGCGAACCTT |
| 129m hutg-rev | 654 | 100 µM | 20.0 µl for 1ml | GACCTTCCTCATCCCACT |
| Actin fwd | 114 | 100 µM | 5.0 µl for 1ml | TGT TAC CAA CTG GGA CGA CA |
| Actin rev | 115 | 100 µM | 5.0 µl for 1ml | GAC ATG CAA GGA GTG CAA GA |
|
| Expected Bands: | Band Size: 500.0 | Description: 500 actin | (text displayed in the image) |
| Band Size: 750.0 | Description: 750 tg | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |