PCR:	p53 neo
Name of Positive CTRL:	p53 neo
Annealing Temperature:	55.0 °C
Number of cycles:	30.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	neo-3	624	100 µM	20.0 µl for 1ml	GCTCTTCAGCAATATCACGG
	neo-5	625	100 µM	20.0 µl for 1ml	GGAGAGGCTATTCGGCTATG
Expected Bands:	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
	Band Size: 650.0	Description: 650 neo	(text displayed in the image)
More Information in PDF:		view PDF