| PCR: | mGluR5 |
| Name of Positive CTRL: | mGluR5 wt/ko |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| grmko-common | 645 | 100 µM | 20.0 µl for 1ml | CACATGCCAGGTGACATCAT |
| grmko-mut_RV | 647 | 100 µM | 10.0 µl for 1ml | CACGAGACTAGTGAGACGTG |
| grmko-wt_RV | 646 | 100 µM | 10.0 µl for 1ml | CCATGCTGGTTGCAGAGTAA |
|
| Expected Bands: | Band Size: 442.0 | Description: 442 wt | (text displayed in the image) |
| Band Size: 650.0 | Description: 650 mut | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |