| PCR: | hOR |
| Name of Positive CTRL: | hOR 9 |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 120 s | | Hot Start: | HSXL_57_35 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| OR PrP, FW | 643 | 100 µM | 10.0 µl for 1ml | CACCTCAGGGCGGTGGTGG |
| PrPCterm, RW | 644 | 100 µM | 10.0 µl for 1ml | TCATCCCACGATCAGGAAGATGAGG |
|
| Expected Bands: | Band Size: 620.0 | Description: 620 wt | (text displayed in the image) |
| Band Size: 836.0 | Description: 836 9 OR | (text displayed in the image) |
| Band Size: 908.0 | Description: 908 12 OR | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |