| PCR: | DATcre |
| Name of Positive CTRL: | DATcre |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| DATcre_rev | 652 | 100 µM | 20.0 µl for 1ml | CGGCAATATGGTGGAAAATAAC |
| DATcre_wt_fwd | 651 | 100 µM | 30.0 µl for 1ml | TGGTGTAAAGTGGAAGGAGAC |
| DATcre_wt_rev | 650 | 100 µM | 10.0 µl for 1ml | TTTCTTGACGTGTTGGTTTCC |
|
| Expected Bands: | Band Size: 97.0 | Description: 97 wt | (text displayed in the image) |
| Band Size: 141.0 | Description: 141 tg | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |