PCR:	Sirt3 flox
Name of Positive CTRL:	Sirt3 flox
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mSIRT3 R1	640	100 µM	10.0 µl for 1ml	CAACATGAAAAAGCGCTTGGG
	PCALL2-1 F	639	100 µM	10.0 µl for 1ml	GGATCCACTAGTTCTAGCTAG
Expected Bands:	no expected bands in db
More Information in PDF:		view PDF