| PCR: | CPT1mt |
| Name of Positive CTRL: | CPT1mt |
Annealing Temperature: | 62.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| CPT1mt L2 F | 629 | 100 µM | 10.0 µl for 1ml | GCCTTCTTCTTTTTCCTACAGCTC |
| CPT1mt L2 R | 630 | 100 µM | 10.0 µl for 1ml | TGCTAAAGCGCATGCTCCAGACTGC |
| CPT1mt wt F | 627 | 100 µM | 10.0 µl for 1ml | GGAAGCACTTGCTCTCCCAAAGTCG |
| CPT1mt wt R | 628 | 100 µM | 10.0 µl for 1ml | CCCACACACCAGGTTAGCCTTTAAG |
|
| Expected Bands: | Band Size: 169.0 | Description: 169 L2 | (text displayed in the image) |
| Band Size: 274.0 | Description: 274 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |