| PCR: | Prnp-GFP |
| Name of Positive CTRL: | Prnp-GFP |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 75 wt | 619 | 100 µM | 10.0 µl for 1ml | AGATCCGCCACAACATCGAGG |
| 77 common | 621 | 100 µM | 20.0 µl for 1ml | GAGCTACAGGTGGATAACCCC |
| 79 ko | 620 | 100 µM | 10.0 µl for 1ml | GAGCAGATGTGCGTCACCCAG |
|
| Expected Bands: | Band Size: 204.0 | Description: 204 wt | (text displayed in the image) |
| Band Size: 285.0 | Description: 285 GFP | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |