PCR: | MACC-Cre |
Name of Positive CTRL: | MACC-Cre |
Annealing Temperature: | 62.0 °C | Number of cycles: | 40.0 |
Extension Time: | 60 s | Hot Start: | HS 60 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Actin fwd | 114 | 100 µM | 10.0 µl for 1ml | TGT TAC CAA CTG GGA CGA CA |
| Actin rev | 115 | 100 µM | 10.0 µl for 1ml | GAC ATG CAA GGA GTG CAA GA |
| MACCCreF | 617 | 100 µM | 20.0 µl for 1ml | CGGTCGATGCAACGAGTGATGAGG |
| MACCCreR | 618 | 100 µM | 20.0 µl for 1ml | CGC CGC ATA ACC AGT GAA AC |
|
Expected Bands: | Band Size: 500.0 | Description: 500 Actin | (text displayed in the image) |
| Band Size: 660.0 | Description: 660 MACCre | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|