PCR:	TetO
Name of Positive CTRL:	TetO
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	TetO 1-17	615	100 µM	10.0 µl for 1ml	GCGGCCGCCAACTCTCG
	TetO 419-395	616	100 µM	10.0 µl for 1ml	TCAAAACAGCGTGGATGGCGTCTC
Expected Bands:	Band Size: 420.0	Description: 420 TetO	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF