PCR:	TREM2 ko
Name of Positive CTRL:	TREM2 ko
Annealing Temperature:	57.5 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	5.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	5.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	TREM2 24498	571	100 µM	20.0 µl for 1ml	TTACACAAGACTGGAGCCCTGAGGA
	TREM2 25393 rev	569	100 µM	20.0 µl for 1ml	TCTGACCACAGGTGTTCCCG
Expected Bands:	Band Size: 316.0	Description: 316 ko	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
	Band Size: 1000.0	Description: 1000 unsp	(text displayed in the image)
More Information in PDF:		view PDF