PCR: | SARM |
Name of Positive CTRL: | SARM |
Annealing Temperature: | 60.0 °C | Number of cycles: | 35.0 |
Extension Time: | 30 s | Hot Start: | HS 60 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| SARM 28733 | 596 | 100 µM | 20.0 µl for 1ml | TCCTCTTGTTCCCAAAGGC |
| SARM 29037 rev | 597 | 100 µM | 10.0 µl for 1ml | AGGGAAGCTCAAGGGTTAGAG |
| SARM 36395 rev | 598 | 100 µM | 10.0 µl for 1ml | ACACCACCAAGGGGAGACT |
|
Expected Bands: | Band Size: 305.0 | Description: 305 endog | (text displayed in the image) |
| Band Size: 417.0 | Description: 417 del | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|