| PCR: | IL34 |
| Name of Positive CTRL: | IL34 |
Annealing Temperature: | 55.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 53 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| IL34 305959 | 593 | 100 µM | 20.0 µl for 1ml | TCAGATACAAATATGAAATTAGAG |
| IL34 306329 | 595 | 100 µM | 10.0 µl for 1ml | TGCTGGCAAAGGGCTAAGAA |
| IL-34 306539 | 594 | 100 µM | 10.0 µl for 1ml | GTCAGTATCGGCGGAATT |
|
| Expected Bands: | Band Size: 421.0 | Description: 421 wt | (text displayed in the image) |
| Band Size: 581.0 | Description: 581 IL34 | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |