PCR:	MAB
Name of Positive CTRL:	MAB
Annealing Temperature:	59.0 °C
Number of cycles:	40.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	AL22	591	100 µM	20.0 µl for 1ml	ACCACACCCTCCAAACAAAG
	AL23	592	100 µM	20.0 µl for 1ml	ACATTCTGTAGGGGCCAGTG
Expected Bands:	Band Size: 150.0	Description: 150 MAB tg	(text displayed in the image)
	Band Size: 510.0	Description: 510 actin	(text displayed in the image)
More Information in PDF:		view PDF